Page 1 of 1
Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sat Apr 09, 2016 12:48 pm
by Johannes
Hi,
I have just come across this recent article about the presence of HCMV in ASPS. I have not yet found the full article, but the abstract is below. Perhaps this will lead to another treatment option!?
Best,
Johannes
Appl Immunohistochem Mol Morphol. 2016 Mar 17. [Epub ahead of print]
Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.
Price RL1, Harkins L, Chiocca EA, Zhang PJ, Kurt H, Iwenofu OH.
Author information
1*Department of Neurological Surgery, Washington University, St Louis, MO †Department of Medicine-Hematology Oncology, University Alabama at Birmingham, Birmingham, AL ‡Department of Neurological Surgery, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Boston, MA §Department of Pathology and Laboratory Medicine, Hospital of the University of Pennsylvania, Philadelphia, PA ∥Department of Pathology and Laboratory Medicine, The Ohio State University Wexner Medical Center, Columbus, OH ¶Department of Pathology and Laboratory Medicine, MD Anderson Cancer Center, Houston, TX.
Abstract Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sat Apr 09, 2016 7:54 pm
by D.ap
Johannes
Thanks for the link
http://www.ncbi.nlm.nih.gov/m/pubmed/26990748/
Josh had shingles just before he became symtomatic with leg pains
I was taken back as having a 30 year old have shingles was to me not a normal event ?
http://www.cdc.gov/cmv/overview.html
He's always been reactive with welts after bug bites?
Love
Debbie
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sat Apr 09, 2016 8:05 pm
by D.ap
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sat Apr 09, 2016 8:52 pm
by D.ap
Another sarcoma that possible uses lactate(like asps) + viruses to progress
Kaposi's sarcoma herpes virus microRNAs induce metabolic transformation of infected cells.
http://www.ncbi.nlm.nih.gov/m/pubmed/25255370/
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sun Apr 10, 2016 7:59 am
by D.ap
Found this interesting to know
Had a feeling this was the case
http://www.cbsnews.com/news/two-thirds- ... as-herpes/
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sun Apr 10, 2016 8:40 am
by Olga
As per original article: "HCMV is present in ASPS and may contribute to its pathogenesis" - it means the chronic virus infection might be the underlying reason to cause the ASPS in first place. It takes years or even decades of having virus the damage the body and immune system that much that the faulty cells are created and escape the immune surveillance. But you have to understand that with sarcoma already existing and spreading in the body, curing the cause of it have little effect on curing the person from the ASPS itself as it is entirely different disease/cells nature now. ASPS is not virus although it might have been caused by body having the virus for so long (viruses are implicated in the initial appearance of numerous cancers now). Probably it is a way to create the prevention strategy in the future. It is like elimination the asbestos from the building has little effect on curing someone who lived there and already has mesothelioma.
But there is a problem.
1. The person is often infected by the virus by his mom during the pregnancy or at the birth.
2. The viruses like that are widely spread and chronic just because they are impossible to treat at this moment, the body can just send them into hiding if the immune system is competent. There is some strategy at the gene engineering or genetically modification level in development.
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sun Apr 10, 2016 9:02 am
by Johannes
Many thanks, Olga, that makes sense.
Johannes
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Mon May 29, 2017 8:20 pm
by EricJBest
I'm not sure that having Cytomegalovirus(HCMV) is completely insignificant when treating ASPS, since some treatments are still methods that suppress the immune system, which allows the virus to come out of hiding. If you read the wiki article about HCMV, you will see that it can be lethal to immunocompromised people, so certainly something to be aware of during treatment. The article implies to me that there may be symptoms of the virus that mimic other diseases, so we assume it is something else. This makes me wonder if there are symptoms of ASPS that should really be blamed on HCMV.
https://en.wikipedia.org/wiki/Human_cytomegalovirus
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Thu Jun 01, 2017 6:39 am
by D.ap
Hi Eric
I believe, as you do ,it is a consideration and could be a big piece of the puzzel for patients with ASPS knowing of this presence of cytomegalovirus being present in ASPS.
Olga ,as I understand it, is not discounting the facts but saying that she feels it could of initiated the sarcoma in the
beginning ,however after the fact to treat it wouldn't be help in the irradiation of the metastasis ?
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Tue Dec 05, 2017 5:57 pm
by D.ap
Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence.
Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
http://journals.lww.com/appliedimmunohi ... oft.3.aspx
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Mon Feb 12, 2018 6:53 pm
by D.ap
“The immune response to human CMV”
Abstract
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals.
Keywords: adoptive transfer, atherosclerosis, CMV disease, CMV immunity, immune senescence, vaccines
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3539762/
“Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects”
http://jem.rupress.org/content/202/5/673/tab-pdf
How memory cells work in the cytomegalovirus-
“Primary Human Cytomegalovirus Infection Induces the Expansion of Virus-Specific Activated and Atypical Memory B Cells”
https://academic.oup.com/jid/article/210/8/1275/2911909
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sun Jul 25, 2021 9:03 am
by D.ap
Primary Human Cytomegalovirus Infection Induces the Expansion of Virus-Specific Activated and Atypical Memory B Cells
Conclusions. Primary CMV infection mobilizes a large pool of memory B cells that includes activated and atypical MBCs. The functional regulation of CMV-specific MBCs may limit the production of antibodies and the control of viral dissemination.
B cells have been generally considered to be positive regulators of immune responses because of their ability to produce antigen-specific antibodies and to activate T cells through antigen presentation. Impairment of B cell development and function may cause inflammatory and autoimmune diseases.
Does reactivation of cytomegalovirus contribute to severe COVID-19 disease?
Posted: Sat Feb 05, 2022 9:06 am
by D.ap
Does reactivation of cytomegalovirus contribute to severe COVID-19 disease?
Abstract
The majority of people infected with SARS-CoV-2 are asymptomatic or have mild to moderate symptoms. However, for unknown reasons, about 15 % have severe pneumonia requiring hospital care and oxygen support, and about 5 % develop acute respiratory distress syndrome, septic shock, and multiorgan failure that result in a high mortality rate. The risk of severe COVID-19 is highest among those who are over 70 years of age. Why severe COVID-19 develops in some people but not others is not understood. Could some cases involve reactivation of latent cytomegalovirus (CMV)?
Key points
Latent human cytomegalovirus (CMV) is carried by 70–90 % of the adult population and is reactivated by inflammation. One third of patients in intensive care reactivate CMV, which doubles their mortality rate; how many COVID-19 patients reactivate latent CMV to complicate their diseases and enhance their mortality rate?
https://immunityageing.biomedcentral.co ... 21-00218-z
Re: Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma
Posted: Sun Sep 04, 2022 7:52 am
by D.ap
Does reactivation of cytomegalovirus contribute to severe COVID-19 disease
Conclusions
In conclusion, CMV reactivation and virus induced immune dysfunction may be underestimated as a driver of immunopathogenesis in patients with severe COVID-19. Therefore, studies should be undertaken to investigate the possibility that CMV reactivation sometimes drives the inflammatory response often persisting in patients long after SARS-CoV-2 is no longer detectable in the patient, and may hence be relevant also for patients with long COVID who still have symptoms three months after they were infected [73]. As antiviral drugs are available that may lower the viral activity and inflammatory response, diagnosing CMV in COVID-19 patients could be well worth the effort.
https://immunityageing.biomedcentral.co ... 21-00218-z